No official torrent yet — requesting it tells the flock what to host next. You cannot seed a catalog-only page.
Cataloged from HuggingFaceBio/Carbon-3B-GGUF
All models by HuggingFaceBio →Carbon is a base DNA model (not instruction-tuned). Use the raw completion front-end so llama.cpp does not apply any chat templating:
If you use llama-cli instead, pass -no-cnv so it does not wrap the prompt
in assistant-style markers (otherwise the model may emit annotation tags such
as <protein_coding_region> instead of DNA).
K-quants are produced with --token-embedding-type Q8_0 --output-tensor-type Q8_0
so the sensitive embedding/output tensors stay at Q8_0 precision (important for
this model's tight DNA-vs-text logit margins).
HybridDNATokenizer support was merged in ggml-org/llama.cpp#23410, so any build from master after that works:
Carbon-500M shares the HybridDNA vocab, so it works as a drop-in draft model. Grab it first:
Then run the standalone tool with --model-draft:
Or serve the 3B with the 500M draft (llama-server accepts the same -md flag):
The source card's Python score() function computes mean log-prob per DNA token. In llama.cpp the closest tools are llama-perplexity for corpus-level perplexity (perplexity = exp(-mean_logprob)):
Or llama-server with logprobs for per-token log-probabilities:
Mirrors the source card's rope_scaling = {type: yarn, factor: 4.0, original_max_position_embeddings: 32768}:
The revision="fns" example from the source card needs custom modeling code (factorized nucleotide supervision head), which only the Python transformers path can load. llama.cpp can't run that branch.
llama.cpp produces byte-for-byte identical token IDs to the Python HybridDNATokenizer (loaded with trust_remote_code=True) on the standard <dna>/metadata/edge-case fixtures shipped in ggml-org/vocabs.
Apache-2.0, inherited from the source model.
llama-completion \ -hf HuggingFaceBio/Carbon-3B-GGUF:Q8_0 \ --prompt "<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG" \ -n 128 --temp 0 --no-display-promptgit clone https://github.com/ggml-org/llama.cppcd llama.cpp && cmake -B build && cmake --build build -jhf download HuggingFaceBio/Carbon-3B-GGUF carbon-3b-bf16.gguf --local-dir ../build/bin/llama-completion -m carbon-3b-bf16.gguf \ -p '<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG' \ -n 64 --temp 0 -no-cnv./build/bin/llama-completion -m carbon-3b-bf16.gguf \ -p '<vertebrate_mammalian><protein_coding_region><dna>ATGCGCTAG' \ -n 64 --temp 0 -no-cnvhf download HuggingFaceBio/Carbon-500M-GGUF carbon-500m-bf16.gguf --local-dir ../build/bin/llama-speculative \ -m carbon-3b-bf16.gguf \ -md carbon-500m-bf16.gguf \ -p '<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG' \ -n 256 --temp 0./build/bin/llama-server \ -m carbon-3b-bf16.gguf \ -md carbon-500m-bf16.gguf \ --draft-max 16 --draft-min 1 \ --port 8080curl -s http://localhost:8080/completion -d '{ "prompt": "<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG", "n_predict": 256, "temperature": 0}' | jq -r .content# one prompt per line in dna_corpus.txt, each wrapped in <dna>...</dna>./build/bin/llama-perplexity -m carbon-3b-bf16.gguf -f dna_corpus.txt --ppl-stride 0./build/bin/llama-server -m carbon-3b-bf16.gguf --port 8080 &curl -s http://localhost:8080/completion -d '{ "prompt": "<dna>GGGCTATAAAGGCCATCGATCGATCGATCGATCGATCGATCG</dna>", "n_predict": 0, "n_probs": 1}' | jq '.completion_probabilities'./build/bin/llama-completion -m carbon-3b-bf16.gguf \ -c 65536 --rope-scaling yarn --rope-scale 4 --yarn-orig-ctx 32768 \ -p '<dna>...' -n 64 --temp 0 -no-cnv